Scientists discovered code annotations!

Discussion in 'Off Topic' started by Cantavanda, Jun 11, 2018.

  1. Cantavanda

    Cantavanda 〜Flower Prince〜

    Joined:
    Jun 23, 2016
    Posts:
    70
    Scientists at Zweinstein University have recently discovered hidden annotations in the DNA code of humans.
    They have done this with many microstopes and picoscopes.
    Is this proof that God made us? And that he has a sense of humour??
    You decide!

    HTML:
    //made his mouth way 2 big lmao
    //im leavin it in LOL
    CGTAGCTAGTCATGCAGATGGTATGGTCCTTAGAAATCGCCGTTGGGCAGAAATTTATCCGGAG
    //this guy is gunna be so DUMB
    CCGTTACGCTTGATGATATGGTGGAGTGCCGTGAATCGCCGAAGTAGCGTTGGGTCGGATCGATAAGTCCTAGTGCGTATACAGGTTTCCCGCGTA
    //imma just put some baboon code in here n see what happen
    CGAGTGCTGATCGTGGGTAATTGGTCGGTCAT
    //spent 7 hours writing this part just to f*** up his toes
    CCGTTTAGCGGTGAGCGAGTTGCGATTCGTGAGGTGGAGTCGAGTGGGTGAGCGTAGGCCTAGC
    source
     
    Samus, Rivo, TheSnidr and 1 other person like this.
  2. ElectroMan

    ElectroMan Jack of All Shades

    Joined:
    Jun 25, 2016
    Posts:
    1
    Looks like He forgot to write into you the funny gene.
     
    Mert, Rivo, Niels and 8 others like this.
  3. Roman P.

    Roman P. Member

    Joined:
    Mar 1, 2017
    Posts:
    211
    didn't they like found code in the string theory as well?
     
    Cantavanda likes this.
  4. FireflyX91

    FireflyX91 Member

    Joined:
    Dec 20, 2017
    Posts:
    11
    Your sense of humour is so warped that it's actually hilarious :D

    I don't understand who you are and why you have the power to make me laugh at toilet paper.

    My favorite line from that article.

    FFS I know I'm too drunk now
     
    Cantavanda likes this.
  5. Wraithious

    Wraithious Member

    Joined:
    Jun 24, 2016
    Posts:
    1,166
    Ugg, got my dna annotated:
    //Breakfast rules
    CGTAGCTAGTCATGCAGATGGTATGGTCCTTAGAAATCGCCGTTGGGCAGAAATTTATCCGGAG
    pancakes.png
     
  6. devonhg

    devonhg Member

    Joined:
    Jun 21, 2016
    Posts:
    25
    If it wasn't for your source, I'd think you were making stuff up.
     

Share This Page

  1. This site uses cookies to help personalise content, tailor your experience and to keep you logged in if you register.
    By continuing to use this site, you are consenting to our use of cookies.
    Dismiss Notice