Scientists discovered code annotations!

Cantavanda

〜Flower Prince〜
Scientists at Zweinstein University have recently discovered hidden annotations in the DNA code of humans.
They have done this with many microstopes and picoscopes.
Is this proof that God made us? And that he has a sense of humour??
You decide!

HTML:
//made his mouth way 2 big lmao
//im leavin it in LOL
CGTAGCTAGTCATGCAGATGGTATGGTCCTTAGAAATCGCCGTTGGGCAGAAATTTATCCGGAG
//this guy is gunna be so DUMB
CCGTTACGCTTGATGATATGGTGGAGTGCCGTGAATCGCCGAAGTAGCGTTGGGTCGGATCGATAAGTCCTAGTGCGTATACAGGTTTCCCGCGTA
//imma just put some baboon code in here n see what happen
CGAGTGCTGATCGTGGGTAATTGGTCGGTCAT
//spent 7 hours writing this part just to f*** up his toes
CCGTTTAGCGGTGAGCGAGTTGCGATTCGTGAGGTGGAGTCGAGTGGGTGAGCGTAGGCCTAGC
source
 

FireflyX91

Member
Your sense of humour is so warped that it's actually hilarious :D

I don't understand who you are and why you have the power to make me laugh at toilet paper.

Some people hold strong opinions on the matter
My favorite line from that article.

FFS I know I'm too drunk now
 
W

Wraithious

Guest
Ugg, got my dna annotated:
//Breakfast rules
CGTAGCTAGTCATGCAGATGGTATGGTCCTTAGAAATCGCCGTTGGGCAGAAATTTATCCGGAG
pancakes.png
 
Top